Transcript: Mouse XM_006526997.1

PREDICTED: Mus musculus ubiquitin domain containing 1 (Ubtd1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ubtd1 (226122)
Length:
1444
CDS:
208..768

Additional Resources:

NCBI RefSeq record:
XM_006526997.1
NBCI Gene record:
Ubtd1 (226122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200367 GCTCAAGTGGAAGAGTGACTA pLKO.1 183 5UTR 100% 4.950 3.465 N Ubtd1 n/a
2 TRCN0000178277 GCTCCAGGAAACAAAGATTCA pLKO.1 693 CDS 100% 4.950 3.465 N Ubtd1 n/a
3 TRCN0000200268 CATCCAGGTCATCATCAACCA pLKO.1 726 CDS 100% 2.640 1.848 N Ubtd1 n/a
4 TRCN0000182661 GCTGCTGAAGCTAATGACCAT pLKO.1 313 CDS 100% 2.640 1.848 N Ubtd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04166 pDONR223 100% 74% 80.6% None (many diffs) n/a
2 ccsbBroad304_04166 pLX_304 0% 74% 80.6% V5 (many diffs) n/a
3 TRCN0000469296 AGACCAATTCCTCTCTACAACCCA pLX_317 61.9% 74% 80.6% V5 (many diffs) n/a
Download CSV