Transcript: Mouse XM_006526998.3

PREDICTED: Mus musculus ER lipid raft associated 1 (Erlin1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erlin1 (226144)
Length:
3761
CDS:
733..1779

Additional Resources:

NCBI RefSeq record:
XM_006526998.3
NBCI Gene record:
Erlin1 (226144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113314 ACCGAATAGAAGTGGTTAATA pLKO.1 998 CDS 100% 15.000 21.000 N Erlin1 n/a
2 TRCN0000316161 ACCGAATAGAAGTGGTTAATA pLKO_005 998 CDS 100% 15.000 21.000 N Erlin1 n/a
3 TRCN0000072457 CCGAATAGAAGTGGTTAATAT pLKO.1 999 CDS 100% 15.000 21.000 N ERLIN1 n/a
4 TRCN0000290362 CCGAATAGAAGTGGTTAATAT pLKO_005 999 CDS 100% 15.000 21.000 N ERLIN1 n/a
5 TRCN0000113312 GCAGACTACGACAAGACTTTA pLKO.1 1063 CDS 100% 13.200 18.480 N Erlin1 n/a
6 TRCN0000316088 GCAGACTACGACAAGACTTTA pLKO_005 1063 CDS 100% 13.200 18.480 N Erlin1 n/a
7 TRCN0000113310 GCCTTATAGTATAGAGGCATT pLKO.1 3278 3UTR 100% 4.050 3.240 N Erlin1 n/a
8 TRCN0000316160 GCCTTATAGTATAGAGGCATT pLKO_005 3278 3UTR 100% 4.050 3.240 N Erlin1 n/a
9 TRCN0000113313 GCTCAAGAAATACCAGGCCAT pLKO.1 1584 CDS 100% 2.160 1.512 N Erlin1 n/a
10 TRCN0000113311 GCAGAGAAGATTGCACAAGTA pLKO.1 1390 CDS 100% 4.950 2.970 N Erlin1 n/a
11 TRCN0000316164 GCAGAGAAGATTGCACAAGTA pLKO_005 1390 CDS 100% 4.950 2.970 N Erlin1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526998.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10207 pDONR223 100% 90.8% 95.4% None (many diffs) n/a
2 ccsbBroad304_10207 pLX_304 0% 90.8% 95.4% V5 (many diffs) n/a
3 TRCN0000468839 GAATGGCCGCAAAGAAATCGCACG pLX_317 44.3% 90.8% 95.4% V5 (many diffs) n/a
Download CSV