Transcript: Mouse XM_006527120.2

PREDICTED: Mus musculus cleavage and polyadenylation specific factor 7 (Cpsf7), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpsf7 (269061)
Length:
3614
CDS:
388..1569

Additional Resources:

NCBI RefSeq record:
XM_006527120.2
NBCI Gene record:
Cpsf7 (269061)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264680 AGACCGGCATGATGATTATTT pLKO_005 1488 CDS 100% 15.000 21.000 N Cpsf7 n/a
2 TRCN0000264677 ATAACCAGCTCTTAGGTATTT pLKO_005 2333 3UTR 100% 13.200 18.480 N Cpsf7 n/a
3 TRCN0000264678 ATCCAGGTTATCCGCTCTATA pLKO_005 475 CDS 100% 13.200 18.480 N Cpsf7 n/a
4 TRCN0000264681 CCAGCGTGTTGCCCTACTTTA pLKO_005 809 CDS 100% 13.200 18.480 N Cpsf7 n/a
5 TRCN0000174672 GATCAGATTGACCTATATGAT pLKO.1 179 5UTR 100% 5.625 7.875 N Cpsf7 n/a
6 TRCN0000215913 CTCACATATTGACGGTTTATT pLKO.1 2152 3UTR 100% 15.000 12.000 N Cpsf7 n/a
7 TRCN0000264679 ACAGATCAGATTGACCTATAT pLKO_005 176 5UTR 100% 13.200 9.240 N Cpsf7 n/a
8 TRCN0000193728 CCATTGCAGTTATCAAACAGT pLKO.1 1274 CDS 100% 3.000 2.100 N Cpsf7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08975 pDONR223 100% 77% 77.6% None (many diffs) n/a
2 ccsbBroad304_08975 pLX_304 0% 77% 77.6% V5 (many diffs) n/a
3 TRCN0000480428 ACAGCACAGGTGGCTGGTGCGCAC pLX_317 31.1% 77% 77.6% V5 (many diffs) n/a
Download CSV