Transcript: Mouse XM_006527313.2

PREDICTED: Mus musculus ATPase family, AAA domain containing 1 (Atad1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atad1 (67979)
Length:
2911
CDS:
140..1225

Additional Resources:

NCBI RefSeq record:
XM_006527313.2
NBCI Gene record:
Atad1 (67979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527313.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233058 ATGTTACTTGGAGTGATATAG pLKO_005 399 CDS 100% 13.200 18.480 N ATAD1 n/a
2 TRCN0000101557 GCATGTTACTTGGAGTGATAT pLKO.1 397 CDS 100% 13.200 18.480 N Atad1 n/a
3 TRCN0000148038 GCATGTTACTTGGAGTGATAT pLKO.1 397 CDS 100% 13.200 18.480 N ATAD1 n/a
4 TRCN0000308412 GCATGTTACTTGGAGTGATAT pLKO_005 397 CDS 100% 13.200 18.480 N Atad1 n/a
5 TRCN0000101556 GCGATGATGAAAGCTCAGTTT pLKO.1 767 CDS 100% 4.950 3.960 N Atad1 n/a
6 TRCN0000308342 GCGATGATGAAAGCTCAGTTT pLKO_005 767 CDS 100% 4.950 3.960 N Atad1 n/a
7 TRCN0000101558 GCCTACACGATTTCATATTAA pLKO.1 892 CDS 100% 15.000 10.500 N Atad1 n/a
8 TRCN0000308341 GCCTACACGATTTCATATTAA pLKO_005 892 CDS 100% 15.000 10.500 N Atad1 n/a
9 TRCN0000101555 GCCAAGAAACATATCCTGTTT pLKO.1 2594 3UTR 100% 0.495 0.347 N Atad1 n/a
10 TRCN0000101559 CATCTAGTAGACCCTCTTAAT pLKO.1 374 CDS 100% 13.200 7.920 N Atad1 n/a
11 TRCN0000308410 CATCTAGTAGACCCTCTTAAT pLKO_005 374 CDS 100% 13.200 7.920 N Atad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527313.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12874 pDONR223 100% 38.4% 41.8% None (many diffs) n/a
2 ccsbBroad304_12874 pLX_304 0% 38.4% 41.8% V5 (many diffs) n/a
3 TRCN0000471361 TGATAAGCCGGCACACGCCACCCT pLX_317 98.7% 38.4% 41.8% V5 (many diffs) n/a
Download CSV