Transcript: Mouse XM_006527408.3

PREDICTED: Mus musculus tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2 (Tnks2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tnks2 (74493)
Length:
6308
CDS:
309..3638

Additional Resources:

NCBI RefSeq record:
XM_006527408.3
NBCI Gene record:
Tnks2 (74493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238900 CATCGACACAAGCTGATTAAA pLKO_005 2901 CDS 100% 15.000 21.000 N Tnks2 n/a
2 TRCN0000238898 TACATCGCTTTGTACTATAAA pLKO_005 4057 3UTR 100% 15.000 21.000 N Tnks2 n/a
3 TRCN0000238902 TTGAGCACTTGATGGATATAT pLKO_005 2797 CDS 100% 15.000 21.000 N Tnks2 n/a
4 TRCN0000053239 GCTGCCAAGAAGGGTTGTTTA pLKO.1 2091 CDS 100% 13.200 10.560 N TNKS2 n/a
5 TRCN0000238899 ACCCAAATGCTCGGGATAATT pLKO_005 655 CDS 100% 15.000 10.500 N Tnks2 n/a
6 TRCN0000238901 CATTTGGCAGCTGGTTATAAT pLKO_005 2187 CDS 100% 15.000 10.500 N Tnks2 n/a
7 TRCN0000423098 GTGTCAATGCCACGGACAAAT pLKO_005 2347 CDS 100% 13.200 9.240 N TNKS2 n/a
8 TRCN0000053240 CCAGTGTAAATGGCCTAGCAT pLKO.1 3523 CDS 100% 3.000 2.100 N TNKS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488738 AATGCTGACTGTTTTCTGTTTCAG pLX_317 11.8% 86.1% 92.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV