Transcript: Mouse XM_006527819.3

PREDICTED: Mus musculus AF4/FMR2 family, member 2 (Aff2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aff2 (14266)
Length:
9673
CDS:
1554..5450

Additional Resources:

NCBI RefSeq record:
XM_006527819.3
NBCI Gene record:
Aff2 (14266)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103534 CCCAAATTGGTACAGTTGAAA pLKO.1 2242 CDS 100% 5.625 4.500 N Aff2 n/a
2 TRCN0000103533 CCACCTTGCATTACTTCTAAA pLKO.1 3726 CDS 100% 13.200 9.240 N Aff2 n/a
3 TRCN0000103532 GCCACCTTGCATTACTTCTAA pLKO.1 3725 CDS 100% 5.625 3.938 N Aff2 n/a
4 TRCN0000103530 CTCATCCTTTACCAGTGCCTT pLKO.1 5480 3UTR 100% 2.640 1.848 N Aff2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527819.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06219 pDONR223 100% 83.6% 82.7% None (many diffs) n/a
2 ccsbBroad304_06219 pLX_304 0% 83.6% 82.7% V5 (many diffs) n/a
3 TRCN0000480612 CGTGCTGAAAAAACACGTATAAAG pLX_317 9.1% 83.6% 82.7% V5 (many diffs) n/a
Download CSV