Transcript: Mouse XM_006527998.1

PREDICTED: Mus musculus START domain containing 8 (Stard8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stard8 (236920)
Length:
5067
CDS:
240..3539

Additional Resources:

NCBI RefSeq record:
XM_006527998.1
NBCI Gene record:
Stard8 (236920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047901 GCTTCCTCAAGCACCTTGAAT pLKO.1 859 CDS 100% 5.625 3.938 N STARD8 n/a
2 TRCN0000106147 CCAGATCAACTTGCTTCACAA pLKO.1 2027 CDS 100% 4.950 3.465 N Stard8 n/a
3 TRCN0000106145 CCCTACTTTGACCCACACTTT pLKO.1 4178 3UTR 100% 4.950 3.465 N Stard8 n/a
4 TRCN0000106148 CGGCCTATGATGTGGCTGATT pLKO.1 2374 CDS 100% 4.950 3.465 N Stard8 n/a
5 TRCN0000047899 GACTGGTACAACAAAGTCTTT pLKO.1 3435 CDS 100% 4.950 3.465 N STARD8 n/a
6 TRCN0000106146 GCTGATTTACTGAAGCAGTAT pLKO.1 2388 CDS 100% 4.950 3.465 N Stard8 n/a
7 TRCN0000106149 CCAAGTAACCAACCCTTCCTT pLKO.1 780 CDS 100% 3.000 2.100 N Stard8 n/a
8 TRCN0000431776 TGATCAGTGACTGCAAGAAAC pLKO_005 2773 CDS 100% 10.800 6.480 N STARD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02235 pDONR223 100% 77.3% 78.8% None (many diffs) n/a
2 ccsbBroad304_02235 pLX_304 0% 77.3% 78.8% V5 (many diffs) n/a
3 TRCN0000466173 AGTTAAATACTTTACTAGTAGTTC pLX_317 11.6% 77.3% 78.8% V5 (many diffs) n/a
Download CSV