Transcript: Mouse XM_006528316.3

PREDICTED: Mus musculus Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 (Arhgef6), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef6 (73341)
Length:
4982
CDS:
1100..2956

Additional Resources:

NCBI RefSeq record:
XM_006528316.3
NBCI Gene record:
Arhgef6 (73341)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110191 CCGAGGAAGAATACGTGATTA pLKO.1 2556 CDS 100% 13.200 18.480 N Arhgef6 n/a
2 TRCN0000110193 CCCTAAGGCTATCAAAGGATT pLKO.1 1312 CDS 100% 4.950 6.930 N Arhgef6 n/a
3 TRCN0000110192 CCGTGGAGTTTAAGTTGCCTA pLKO.1 2399 CDS 100% 2.640 3.696 N Arhgef6 n/a
4 TRCN0000110194 CCTAAGGCTATCAAAGGATTT pLKO.1 1313 CDS 100% 10.800 8.640 N Arhgef6 n/a
5 TRCN0000110190 CCACTGTTTGATTCAGAGTTT pLKO.1 3103 3UTR 100% 4.950 3.465 N Arhgef6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528316.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11368 pDONR223 100% 77.5% 80.5% None (many diffs) n/a
2 ccsbBroad304_11368 pLX_304 0% 77.5% 80.5% V5 (many diffs) n/a
3 TRCN0000481486 CTGCCTACAAACCATCTCCCTGGA pLX_317 29.9% 77.5% 80.5% V5 (many diffs) n/a
Download CSV