Transcript: Mouse XM_006528429.2

PREDICTED: Mus musculus claudin 34C2 (Cldn34c2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cldn34c2 (625591)
Length:
957
CDS:
281..919

Additional Resources:

NCBI RefSeq record:
XM_006528429.2
NBCI Gene record:
Cldn34c2 (625591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090731 GCTATTGCTAGCACCTTTATT pLKO.1 686 CDS 100% 15.000 7.500 Y LOC434847 n/a
2 TRCN0000091154 CAGAGGAACTGCATAAGAATA pLKO.1 627 CDS 100% 13.200 6.600 Y LOC434837 n/a
3 TRCN0000090693 CCCTTCCAGAATGGCGAATTT pLKO.1 369 CDS 100% 13.200 6.600 Y Gm14957 n/a
4 TRCN0000090930 CTTTGCTCTACAGCAGTTATA pLKO.1 604 CDS 100% 13.200 6.600 Y Cldn34c1 n/a
5 TRCN0000091121 CAACCTTGTTCCTTTGGATAT pLKO.1 517 CDS 100% 10.800 5.400 Y Cldn34c3 n/a
6 TRCN0000090696 CCATTACTACACCTGCCATAA pLKO.1 496 CDS 100% 10.800 5.400 Y Gm14957 n/a
7 TRCN0000091202 CACAGAGGAACTGCATAAGAA pLKO.1 625 CDS 100% 5.625 2.813 Y LOC433972 n/a
8 TRCN0000091199 CAGCAAGGAAGAGGTATCTTT pLKO.1 742 CDS 100% 5.625 2.813 Y LOC433972 n/a
9 TRCN0000090695 CCAGCAAGGAAGAGGTATCTT pLKO.1 741 CDS 100% 5.625 2.813 Y Gm14957 n/a
10 TRCN0000090694 CCTGAGAGATTGCCATTACTA pLKO.1 484 CDS 100% 5.625 2.813 Y Gm14957 n/a
11 TRCN0000091155 CTGTCCTTCAATGGAAATCAA pLKO.1 880 CDS 100% 5.625 2.813 Y LOC434837 n/a
12 TRCN0000090813 GCAGCATACATAACCTTGAAA pLKO.1 930 3UTR 100% 5.625 2.813 Y LOC434834 n/a
13 TRCN0000090929 GCCATGGGATTGGCATACATA pLKO.1 815 CDS 100% 5.625 2.813 Y Cldn34c1 n/a
14 TRCN0000090932 CATAATGTGCAATACCTCTAT pLKO.1 346 CDS 100% 4.950 2.475 Y Cldn34c1 n/a
15 TRCN0000091200 CCAAATAAGAGGTTTCACTTT pLKO.1 310 CDS 100% 4.950 2.475 Y LOC433972 n/a
16 TRCN0000091201 GAGGTTTCACTTTAGCTACAA pLKO.1 318 CDS 100% 4.950 2.475 Y LOC433972 n/a
17 TRCN0000091157 GCCACCACAACCACAACTCAA pLKO.1 459 CDS 100% 4.950 2.475 Y LOC434837 n/a
18 TRCN0000090697 GCGAATTTGCTACTTGAACAA pLKO.1 382 CDS 100% 4.950 2.475 Y Gm14957 n/a
19 TRCN0000091156 CCACATATTTGATGCCAGCAT pLKO.1 262 5UTR 100% 2.640 1.320 Y LOC434837 n/a
20 TRCN0000090728 CCTGCTAAACAAGTCTGCCAA pLKO.1 286 CDS 100% 2.640 1.320 Y LOC434847 n/a
21 TRCN0000090732 GAAGAGGTATCTTTCCTGCAA pLKO.1 749 CDS 100% 2.640 1.320 Y LOC434847 n/a
22 TRCN0000091119 CTTTGCTCTACAGCAGTTAAA pLKO.1 604 CDS 100% 13.200 6.600 Y Cldn34c3 n/a
23 TRCN0000091120 GCCCTTCCAGAATGGCGAAAT pLKO.1 368 CDS 100% 10.800 5.400 Y Cldn34c3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.