Transcript: Mouse XM_006528803.2

PREDICTED: Mus musculus lipoma HMGIC fusion partner-like 1 (Lhfpl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhfpl1 (237091)
Length:
1780
CDS:
430..993

Additional Resources:

NCBI RefSeq record:
XM_006528803.2
NBCI Gene record:
Lhfpl1 (237091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248046 TAGACTCGGCTGGGCCTATTA pLKO_005 819 CDS 100% 13.200 18.480 N Lhfpl1 n/a
2 TRCN0000217806 CCAGTATCTTTCAGCACATTC pLKO.1 550 CDS 100% 10.800 7.560 N Lhfpl1 n/a
3 TRCN0000248045 GTGGCCAGTTCTACCAGTTAC pLKO_005 490 CDS 100% 10.800 7.560 N Lhfpl1 n/a
4 TRCN0000200825 GCACATCACAAGAATTACTAT pLKO.1 1438 3UTR 100% 5.625 3.938 N Lhfpl1 n/a
5 TRCN0000248048 ATGTACTTCCCACTTACTTTA pLKO_005 1301 3UTR 100% 13.200 7.920 N Lhfpl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13602 pDONR223 100% 90.3% 94.6% None (many diffs) n/a
2 ccsbBroad304_13602 pLX_304 0% 90.3% 94.6% V5 (many diffs) n/a
3 TRCN0000474507 TACTAACTTACGCTAGCGGCTCCT pLX_317 95.2% 90.3% 94.6% V5 (many diffs) n/a
4 ccsbBroadEn_05477 pDONR223 100% 76.8% 80.4% None (many diffs) n/a
5 ccsbBroad304_05477 pLX_304 0% 76.8% 80.4% V5 (many diffs) n/a
6 TRCN0000480663 GATCCGAGCACACTCAAGCAAAAA pLX_317 55% 76.8% 80.4% V5 (many diffs) n/a
Download CSV