Construct: ORF TRCN0000480663
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011745.1_s317c1
- Derived from:
- ccsbBroadEn_05477
- DNA Barcode:
- GATCCGAGCACACTCAAGCAAAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LHFPL1 (340596)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480663
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 340596 | LHFPL1 | LHFPL tetraspan subfamily m... | NM_178175.4 | 100% | 100% | |
2 | human | 340596 | LHFPL1 | LHFPL tetraspan subfamily m... | XM_011530944.2 | 100% | 100% | |
3 | human | 340596 | LHFPL1 | LHFPL tetraspan subfamily m... | XM_011530943.2 | 90.5% | 90.5% | 1_69del |
4 | human | 340596 | LHFPL1 | LHFPL tetraspan subfamily m... | XM_017029485.1 | 90.5% | 90.5% | 1_69del |
5 | human | 340596 | LHFPL1 | LHFPL tetraspan subfamily m... | XM_011530946.2 | 85% | 85% | 380_381ins99 |
6 | human | 340596 | LHFPL1 | LHFPL tetraspan subfamily m... | XM_024452370.1 | 67.2% | 65.2% | (many diffs) |
7 | mouse | 237091 | Lhfpl1 | lipoma HMGIC fusion partner... | NM_178358.3 | 90.9% | 94.5% | (many diffs) |
8 | mouse | 237091 | Lhfpl1 | lipoma HMGIC fusion partner... | XM_006528800.2 | 90.9% | 94.5% | (many diffs) |
9 | mouse | 237091 | Lhfpl1 | lipoma HMGIC fusion partner... | XM_006528801.3 | 90.9% | 94.5% | (many diffs) |
10 | mouse | 237091 | Lhfpl1 | lipoma HMGIC fusion partner... | XM_006528803.2 | 76.8% | 80.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 729
- ORF length:
- 660
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaggagcagc ctgaccatgg tgggaaccct ctgggccttc ctgtcccttg 121 ttactgctgt gaccagttct accagttact tcctacctta ctggctcttt ggatcccaga 181 tggggaagcc agtgtcattc agcacattcc ggaggtgcaa ctaccctgtg cggggagagg 241 gacacagtct gatcatggtg gaagaatgtg ggcgctatgc cagcttcaat gccatcccaa 301 gcctggcctg gcagatgtgc acagtggtga caggtgccgg ctgtgctctg ctgctcctgg 361 tggCACTAGC TGCTGTCCTG GGTTGCTGCA TGGAGGAGCT CATCTCCAGA ATGATGGGAC 421 GTTGCATGGG AGCAGCGCAG TTTGTTGGAG GGCTGCTGAT AAGCTCAGGC TGTGCCTTAT 481 ACCCTTTAGG ATGGAATAGC CCGGAGATAA TGCAAACATG TGGGAATGTC TCCAATCAAT 541 TTCAGTTAGG TACCTGTCGG CTTGGCTGGG CCTATTACTG TGCTGGAGGT GGAGCAGCTG 601 CAGCCATGTT GATCTGCACC TGGCTCTCTT GCTTTGCTGG AAGAAACCCC AAGCCTGTCA 661 TATTGGTGGA GAGCATCATG AGGAATACCA ATTCTTATGC TATGGAGCTT GACCATTGCC 721 TCAAACCTTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 781 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 841 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGATCCG AGCACACTCA AGCAAAAAAC 901 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt