Transcript: Mouse XM_006528868.3

PREDICTED: Mus musculus spindlin family, member 2C (Spin2c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spin2c (278240)
Length:
1495
CDS:
445..1218

Additional Resources:

NCBI RefSeq record:
XM_006528868.3
NBCI Gene record:
Spin2c (278240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087936 TGCGCCTTGCTAATACCATAA pLKO.1 803 CDS 100% 10.800 15.120 N Spin2c n/a
2 TRCN0000087935 CGCCTTGCTAATACCATAATT pLKO.1 805 CDS 100% 15.000 10.500 N Spin2c n/a
3 TRCN0000087937 GCAAGGTCATTCACCAAGTTA pLKO.1 1115 CDS 100% 5.625 3.938 N Spin2c n/a
4 TRCN0000087934 CCCTCTCTCTACCTGGTGAAA pLKO.1 676 CDS 100% 4.950 3.465 N Spin2c n/a
5 TRCN0000087933 CCCAGAAACTTTGCCAGCAAT pLKO.1 1318 3UTR 100% 4.950 2.970 N Spin2c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08380 pDONR223 100% 82.7% 81% None (many diffs) n/a
2 ccsbBroad304_08380 pLX_304 0% 82.7% 81% V5 (many diffs) n/a
3 TRCN0000468578 AGTACGTTCTATCTCATTAAGTTA pLX_317 50.1% 82.7% 81% V5 (many diffs) n/a
4 ccsbBroadEn_05691 pDONR223 100% 82.6% 81.8% None (many diffs) n/a
5 ccsbBroad304_05691 pLX_304 0% 82.6% 81.8% V5 (many diffs) n/a
6 TRCN0000471674 AACTTGCTACCGGAACGACTTCAT pLX_317 50.1% 82.6% 81.8% V5 (many diffs) n/a
Download CSV