Transcript: Mouse XM_006528924.3

PREDICTED: Mus musculus SH3-domain kinase binding protein 1 (Sh3kbp1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sh3kbp1 (58194)
Length:
5009
CDS:
376..2505

Additional Resources:

NCBI RefSeq record:
XM_006528924.3
NBCI Gene record:
Sh3kbp1 (58194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295442 AGTTACTTCCATCGGACTTTG pLKO_005 1478 CDS 100% 10.800 8.640 N Sh3kbp1 n/a
2 TRCN0000088508 CCCACCACTCTAAGAGAAATT pLKO.1 3061 3UTR 100% 13.200 9.240 N Sh3kbp1 n/a
3 TRCN0000288113 CCCACCACTCTAAGAGAAATT pLKO_005 3061 3UTR 100% 13.200 9.240 N Sh3kbp1 n/a
4 TRCN0000088511 GAAGATAAAGAGGAACACATT pLKO.1 2047 CDS 100% 4.950 3.465 N Sh3kbp1 n/a
5 TRCN0000288112 GAAGATAAAGAGGAACACATT pLKO_005 2047 CDS 100% 4.950 3.465 N Sh3kbp1 n/a
6 TRCN0000088509 GCACGATGTATCCAGTGGAAA pLKO.1 597 CDS 100% 4.950 3.465 N Sh3kbp1 n/a
7 TRCN0000288114 GCACGATGTATCCAGTGGAAA pLKO_005 597 CDS 100% 4.950 3.465 N Sh3kbp1 n/a
8 TRCN0000088510 CGTGTCAAAGAAGACTTCCAA pLKO.1 2091 CDS 100% 3.000 2.100 N Sh3kbp1 n/a
9 TRCN0000306728 CGTGTCAAAGAAGACTTCCAA pLKO_005 2091 CDS 100% 3.000 2.100 N Sh3kbp1 n/a
10 TRCN0000038019 CACAACACAAATTCCATCCAA pLKO.1 2651 3UTR 100% 3.000 1.800 N SH3KBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528924.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08160 pDONR223 100% 85.2% 88.1% None (many diffs) n/a
2 ccsbBroad304_08160 pLX_304 0% 85.2% 88.1% V5 (many diffs) n/a
3 TRCN0000475526 GGACACTCCTACTCCAAGGCTAAA pLX_317 7% 85.2% 88.1% V5 (many diffs) n/a
Download CSV