Transcript: Mouse XM_006529169.2

PREDICTED: Mus musculus LIM homeobox protein 4 (Lhx4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhx4 (16872)
Length:
5480
CDS:
300..1289

Additional Resources:

NCBI RefSeq record:
XM_006529169.2
NBCI Gene record:
Lhx4 (16872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070554 CTTTGCTCAATGGGCTGGATT pLKO.1 1090 CDS 100% 4.950 6.930 N Lhx4 n/a
2 TRCN0000070555 GAAGATTTCTTCAAACGCTTT pLKO.1 351 CDS 100% 4.050 5.670 N Lhx4 n/a
3 TRCN0000428529 ACAGTAATCTGGGCATCATTG pLKO_005 1120 CDS 100% 10.800 8.640 N Lhx4 n/a
4 TRCN0000070557 CCTGGATAAGTTCATCCTGAA pLKO.1 227 5UTR 100% 4.050 3.240 N Lhx4 n/a
5 TRCN0000070553 GCAACCAACATATCCTGGATA pLKO.1 214 5UTR 100% 4.950 3.465 N Lhx4 n/a
6 TRCN0000070556 GATCAAATACTCTCAGAGCTT pLKO.1 897 CDS 100% 2.640 1.848 N Lhx4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04496 pDONR223 100% 78.2% 83.5% None (many diffs) n/a
2 ccsbBroad304_04496 pLX_304 0% 78.2% 83.5% V5 (many diffs) n/a
3 TRCN0000478681 CCCAAGCTATTCGCCCATCTAACG pLX_317 36.3% 78.2% 83.5% V5 (many diffs) n/a
Download CSV