Transcript: Mouse XM_006529354.3

PREDICTED: Mus musculus kelch domain containing 8A (Klhdc8a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Klhdc8a (213417)
Length:
2624
CDS:
474..1526

Additional Resources:

NCBI RefSeq record:
XM_006529354.3
NBCI Gene record:
Klhdc8a (213417)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529354.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176242 GCCTTCGAGGTCTTTGATATA pLKO.1 1044 CDS 100% 13.200 18.480 N Klhdc8a n/a
2 TRCN0000430021 TGTCGTGAGAGATAAACTAAT pLKO_005 1874 3UTR 100% 13.200 18.480 N Klhdc8a n/a
3 TRCN0000174928 GCCAAAGATTATCGAGTGTAT pLKO.1 843 CDS 100% 4.950 6.930 N Klhdc8a n/a
4 TRCN0000446357 ACCCTGGACAACCACTTATAC pLKO_005 1128 CDS 100% 13.200 10.560 N Klhdc8a n/a
5 TRCN0000430706 GCCCTAGGAAAGCGGATTATG pLKO_005 699 CDS 100% 13.200 10.560 N Klhdc8a n/a
6 TRCN0000441284 TATGGACTGCTTCGAGGTCTA pLKO_005 608 CDS 100% 4.050 3.240 N Klhdc8a n/a
7 TRCN0000173271 CACCAATCAACTGCCTGTGAA pLKO.1 737 CDS 100% 4.950 3.465 N Klhdc8a n/a
8 TRCN0000415798 ACAATGGATGTGTTCGACATG pLKO_005 1203 CDS 100% 4.050 2.835 N Klhdc8a n/a
9 TRCN0000136322 CTATGACATGCTGAAGGACAT pLKO.1 914 CDS 100% 4.050 2.835 N KLHDC8A n/a
10 TRCN0000194229 GACAATGGATGTGTTCGACAT pLKO.1 1202 CDS 100% 4.050 2.835 N Klhdc8a n/a
11 TRCN0000175763 GCAACACTATGACATGCTGAA pLKO.1 908 CDS 100% 4.050 2.835 N Klhdc8a n/a
12 TRCN0000137954 GATGGCTGAAGATGGAACGAT pLKO.1 1234 CDS 100% 3.000 2.100 N KLHDC8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529354.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08492 pDONR223 100% 88.8% 95.4% None (many diffs) n/a
2 ccsbBroad304_08492 pLX_304 0% 88.8% 95.4% V5 (many diffs) n/a
3 TRCN0000467936 CATGCTGGCGGCGACGTATTATGG pLX_317 34.8% 88.8% 95.4% V5 (many diffs) n/a
Download CSV