Transcript: Mouse XM_006529362.2

PREDICTED: Mus musculus contactin 2 (Cntn2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cntn2 (21367)
Length:
9457
CDS:
228..3350

Additional Resources:

NCBI RefSeq record:
XM_006529362.2
NBCI Gene record:
Cntn2 (21367)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238740 TACGTAGGAGGTAGGATATTT pLKO_005 3492 3UTR 100% 15.000 21.000 N Cntn2 n/a
2 TRCN0000238744 TTGGACGGCACCTTGATTATC pLKO_005 1638 CDS 100% 13.200 18.480 N Cntn2 n/a
3 TRCN0000238741 TCCAGCAGAATCCGCACTAAG pLKO_005 2331 CDS 100% 10.800 8.640 N Cntn2 n/a
4 TRCN0000238743 TGTTCTCCTGCATGGTTATAC pLKO_005 3301 CDS 100% 13.200 9.240 N Cntn2 n/a
5 TRCN0000238742 CTGTGGTTCCTCTCCGAAATG pLKO_005 3034 CDS 100% 10.800 7.560 N Cntn2 n/a
6 TRCN0000010966 GCTGAGAACTTCATGGGCAAA pLKO.1 1701 CDS 100% 4.050 2.835 N CNTN2 n/a
7 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 4623 3UTR 100% 4.950 2.475 Y Gad2 n/a
8 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 4564 3UTR 100% 4.050 2.025 Y Mtif2 n/a
9 TRCN0000263836 CTGGCTTAGACACCTTCTCAA pLKO_005 3459 3UTR 100% 4.950 3.465 N C9orf16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07032 pDONR223 100% 85.8% 90.2% None (many diffs) n/a
2 ccsbBroad304_07032 pLX_304 0% 85.8% 90.2% V5 (many diffs) n/a
3 TRCN0000471080 GGATTTCCTACCACAATTAACATC pLX_317 6.6% 85.8% 90.2% V5 (many diffs) n/a
Download CSV