Transcript: Mouse XM_006529365.1

PREDICTED: Mus musculus cell division cycle 73, Paf1/RNA polymerase II complex component (Cdc73), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdc73 (214498)
Length:
2836
CDS:
265..1311

Additional Resources:

NCBI RefSeq record:
XM_006529365.1
NBCI Gene record:
Cdc73 (214498)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175932 GCGCCTTGATAAAGAGAGATT pLKO.1 702 CDS 100% 4.950 6.930 N Cdc73 n/a
2 TRCN0000241651 CTCGTTTGGAAGGCCATAAAG pLKO_005 728 CDS 100% 13.200 9.240 N Cdc73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04081 pDONR223 100% 58.7% 58.6% None (many diffs) n/a
2 ccsbBroad304_04081 pLX_304 0% 58.7% 58.6% V5 (many diffs) n/a
3 TRCN0000469280 TCCTCTACACAGTTGTTGGGCCGT pLX_317 14.5% 58.7% 58.6% V5 (many diffs) n/a
4 ccsbBroadEn_12569 pDONR223 100% 28% 26.8% None (many diffs) n/a
5 ccsbBroad304_12569 pLX_304 0% 28% 26.8% V5 (many diffs) n/a
6 TRCN0000473561 CGAAATTGACGTATAGCATAATCT pLX_317 20.1% 28% 26.8% V5 (many diffs) n/a
Download CSV