Transcript: Mouse XM_006529407.3

PREDICTED: Mus musculus RAB3 GTPase activating protein subunit 1 (Rab3gap1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rab3gap1 (226407)
Length:
3091
CDS:
304..2124

Additional Resources:

NCBI RefSeq record:
XM_006529407.3
NBCI Gene record:
Rab3gap1 (226407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529407.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200425 GTACTCACCAAGGGACTACAT pLKO.1 1260 CDS 100% 4.950 3.465 N Rab3gap1 n/a
2 TRCN0000178512 CGGATGAAATTCTTGGACGAT pLKO.1 179 5UTR 100% 2.640 1.848 N Rab3gap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529407.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14072 pDONR223 100% 53.3% 40.3% None (many diffs) n/a
2 ccsbBroad304_14072 pLX_304 0% 53.3% 40.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475693 CAAAATATCGTACATTACTGCAAT pLX_317 11.1% 53.3% 40.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15001 pDONR223 53.7% 52% 55.4% None (many diffs) n/a
5 ccsbBroad304_15001 pLX_304 0% 52% 55.4% V5 (many diffs) n/a
Download CSV