Transcript: Mouse XM_006529418.2

PREDICTED: Mus musculus R3H domain containing 1 (R3hdm1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
R3hdm1 (226412)
Length:
4341
CDS:
439..3798

Additional Resources:

NCBI RefSeq record:
XM_006529418.2
NBCI Gene record:
R3hdm1 (226412)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080919 CGCCAGATATTTAGAGTTAAT pLKO.1 1417 CDS 100% 13.200 10.560 N R3hdm1 n/a
2 TRCN0000324818 CGCCAGATATTTAGAGTTAAT pLKO_005 1417 CDS 100% 13.200 10.560 N R3hdm1 n/a
3 TRCN0000080921 GCAGTTGGTTACTTACAACAT pLKO.1 2851 CDS 100% 4.950 3.960 N R3hdm1 n/a
4 TRCN0000324903 GCAGTTGGTTACTTACAACAT pLKO_005 2851 CDS 100% 4.950 3.960 N R3hdm1 n/a
5 TRCN0000080918 CCCATCTGATTGGCTTGTTAA pLKO.1 3846 3UTR 100% 13.200 9.240 N R3hdm1 n/a
6 TRCN0000324816 CCCATCTGATTGGCTTGTTAA pLKO_005 3846 3UTR 100% 13.200 9.240 N R3hdm1 n/a
7 TRCN0000082692 CAGATGAGAATACGTTTGAAA pLKO.1 1243 CDS 100% 5.625 3.938 N R3HDM1 n/a
8 TRCN0000291108 CAGATGAGAATACGTTTGAAA pLKO_005 1243 CDS 100% 5.625 3.938 N R3HDM1 n/a
9 TRCN0000080920 CCAGTCTATTACAGTGTCATT pLKO.1 2800 CDS 100% 4.950 3.465 N R3hdm1 n/a
10 TRCN0000324901 CCAGTCTATTACAGTGTCATT pLKO_005 2800 CDS 100% 4.950 3.465 N R3hdm1 n/a
11 TRCN0000080922 GCCAGCAATCACAGTTCTCTT pLKO.1 1729 CDS 100% 4.950 3.465 N R3hdm1 n/a
12 TRCN0000324815 GCCAGCAATCACAGTTCTCTT pLKO_005 1729 CDS 100% 4.950 3.465 N R3hdm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14089 pDONR223 100% 6.8% 4.5% None (many diffs) n/a
2 ccsbBroad304_14089 pLX_304 0% 6.8% 4.5% V5 (many diffs) n/a
Download CSV