Transcript: Mouse XM_006529677.3

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class N (Pign), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pign (27392)
Length:
4212
CDS:
441..2855

Additional Resources:

NCBI RefSeq record:
XM_006529677.3
NBCI Gene record:
Pign (27392)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529677.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126402 CCTCTTAATTCGGTGGGAATA pLKO.1 1449 CDS 100% 10.800 15.120 N Pign n/a
2 TRCN0000126400 GCCAAACCTTTCTCTAGTAAT pLKO.1 2282 CDS 100% 13.200 9.240 N Pign n/a
3 TRCN0000126401 CCTGTAGAATTTGACTCTCTT pLKO.1 798 CDS 100% 4.950 3.465 N Pign n/a
4 TRCN0000126403 GCTTGTCTTTACCTTGGGTAT pLKO.1 2084 CDS 100% 4.050 2.430 N Pign n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529677.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07902 pDONR223 100% 73.7% 73.4% None (many diffs) n/a
2 ccsbBroad304_07902 pLX_304 0% 73.7% 73.4% V5 (many diffs) n/a
3 TRCN0000478909 CATGCCTACAGCTCCCATTTCCCG pLX_317 13% 73.7% 73.4% V5 (many diffs) n/a
Download CSV