Transcript: Mouse XM_006529762.3

PREDICTED: Mus musculus inhibitor of kappaB kinase epsilon (Ikbke), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ikbke (56489)
Length:
2198
CDS:
413..2119

Additional Resources:

NCBI RefSeq record:
XM_006529762.3
NBCI Gene record:
Ikbke (56489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322246 GGTTGACCTACAGGCCGATTA pLKO_005 1633 CDS 100% 10.800 7.560 N Ikbke n/a
2 TRCN0000026755 CTGGACGATGATGAGAAGTTT pLKO.1 902 CDS 100% 5.625 3.938 N Ikbke n/a
3 TRCN0000222222 CCAAAGTTCGTCCCTAAGGTT pLKO.1 1616 CDS 100% 3.000 2.100 N Ikbke n/a
4 TRCN0000222220 CCAGAAGATTCAGTGTTGTTT pLKO.1 2041 CDS 100% 5.625 3.375 N Ikbke n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487809 ACCGGCGGAAATGCTTGCAGCGTC pLX_317 13.8% 66.4% 68.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_02218 pDONR223 100% 56.2% 57.4% None (many diffs) n/a
3 ccsbBroad304_02218 pLX_304 31.3% 56.2% 57.4% V5 (many diffs) n/a
4 TRCN0000471250 CTATGAAATCCTCCGTGAGACTTA pLX_317 18.2% 56.2% 57.4% V5 (many diffs) n/a
Download CSV