Transcript: Mouse XM_006529764.3

PREDICTED: Mus musculus inhibitor of kappaB kinase epsilon (Ikbke), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ikbke (56489)
Length:
1922
CDS:
408..1904

Additional Resources:

NCBI RefSeq record:
XM_006529764.3
NBCI Gene record:
Ikbke (56489)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322246 GGTTGACCTACAGGCCGATTA pLKO_005 1628 CDS 100% 10.800 7.560 N Ikbke n/a
2 TRCN0000026755 CTGGACGATGATGAGAAGTTT pLKO.1 897 CDS 100% 5.625 3.938 N Ikbke n/a
3 TRCN0000222222 CCAAAGTTCGTCCCTAAGGTT pLKO.1 1611 CDS 100% 3.000 2.100 N Ikbke n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487809 ACCGGCGGAAATGCTTGCAGCGTC pLX_317 13.8% 57.9% 58.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_02218 pDONR223 100% 47.8% 48.1% None (many diffs) n/a
3 ccsbBroad304_02218 pLX_304 31.3% 47.8% 48.1% V5 (many diffs) n/a
4 TRCN0000471250 CTATGAAATCCTCCGTGAGACTTA pLX_317 18.2% 47.8% 48.1% V5 (many diffs) n/a
Download CSV