Transcript: Mouse XM_006529807.3

PREDICTED: Mus musculus integrin-linked kinase-associated serine/threonine phosphatase 2C (Ilkap), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ilkap (67444)
Length:
2404
CDS:
138..1307

Additional Resources:

NCBI RefSeq record:
XM_006529807.3
NBCI Gene record:
Ilkap (67444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081422 GCAATCCTGTGTCGATATAAT pLKO.1 852 CDS 100% 15.000 21.000 N Ilkap n/a
2 TRCN0000081421 GCACCAGAACTTAATCAGGAA pLKO.1 638 CDS 100% 2.640 3.696 N Ilkap n/a
3 TRCN0000366417 GGAATACGAGCCTCGAAATTT pLKO_005 603 CDS 100% 15.000 10.500 N Ilkap n/a
4 TRCN0000366416 GGCAATCCTGTGTCGATATAA pLKO_005 851 CDS 100% 15.000 10.500 N Ilkap n/a
5 TRCN0000081419 CCAGAACTTAATCAGGAAATT pLKO.1 641 CDS 100% 13.200 9.240 N Ilkap n/a
6 TRCN0000375366 GGTCACATCTGTGCCTGATAT pLKO_005 1043 CDS 100% 13.200 9.240 N Ilkap n/a
7 TRCN0000379290 TGTGGACAACATCCTGTATAT pLKO_005 809 CDS 100% 13.200 9.240 N Ilkap n/a
8 TRCN0000366418 CCATGTCATCCTGAACGATAT pLKO_005 509 CDS 100% 10.800 7.560 N Ilkap n/a
9 TRCN0000379222 TTACTCGGGTTTCATACTTTG pLKO_005 562 CDS 100% 10.800 7.560 N Ilkap n/a
10 TRCN0000081420 CCCATGTCATCCTGAACGATA pLKO.1 508 CDS 100% 4.950 3.465 N Ilkap n/a
11 TRCN0000081418 CCTTTACTCTTTGATGATCTT pLKO.1 270 CDS 100% 4.950 3.465 N Ilkap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529807.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04228 pDONR223 100% 82.7% 82.1% None (many diffs) n/a
2 ccsbBroad304_04228 pLX_304 0% 82.7% 82.1% V5 (many diffs) n/a
3 TRCN0000472884 GGGCGTGTACAGTAACTTCTGCAG pLX_317 45% 82.7% 82.1% V5 (many diffs) n/a
Download CSV