Transcript: Mouse XM_006529852.3

PREDICTED: Mus musculus transmembrane and coiled-coil domains 2 (Tmcc2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmcc2 (68875)
Length:
4067
CDS:
625..2586

Additional Resources:

NCBI RefSeq record:
XM_006529852.3
NBCI Gene record:
Tmcc2 (68875)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529852.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124365 CCGAGATCCAACACTCTTTAT pLKO.1 2125 CDS 100% 13.200 18.480 N Tmcc2 n/a
2 TRCN0000425114 AGGATGCTCTAGTCATGTAAG pLKO_005 3174 3UTR 100% 10.800 15.120 N Tmcc2 n/a
3 TRCN0000445284 CAAGGATGTGCTACGCGATAT pLKO_005 1734 CDS 100% 10.800 15.120 N Tmcc2 n/a
4 TRCN0000422460 GAAGCAAGCCTCCTGATTTAA pLKO_005 809 CDS 100% 15.000 12.000 N Tmcc2 n/a
5 TRCN0000124364 CCAGGGCTGCATTATTTGAAT pLKO.1 3115 3UTR 100% 5.625 4.500 N Tmcc2 n/a
6 TRCN0000124366 CCAGCGAACTAAGGCTGCCAT pLKO.1 1461 CDS 100% 0.880 0.704 N Tmcc2 n/a
7 TRCN0000442685 CCGAAGCAAGCCTCCTGATTT pLKO_005 807 CDS 100% 13.200 9.240 N TMCC2 n/a
8 TRCN0000434037 AGGGACACTCTCAGCCAAATG pLKO_005 3078 3UTR 100% 10.800 7.560 N Tmcc2 n/a
9 TRCN0000438436 CCATGGAGATGGTCTGGATAA pLKO_005 3266 3UTR 100% 10.800 7.560 N Tmcc2 n/a
10 TRCN0000421939 TCTCAGAGGGCTCCATGTTTG pLKO_005 845 CDS 100% 10.800 7.560 N Tmcc2 n/a
11 TRCN0000420579 AGTCCTCACCTGCTTCGTAAG pLKO_005 1189 CDS 100% 6.000 4.200 N Tmcc2 n/a
12 TRCN0000124368 ACTGCTTTCAACCGGGTGTTA pLKO.1 1060 CDS 100% 4.950 3.465 N Tmcc2 n/a
13 TRCN0000423231 AGATCACTGAGCAGATCAAGA pLKO_005 1508 CDS 100% 4.950 3.465 N Tmcc2 n/a
14 TRCN0000124367 CCAGAATGAAATGACCAACCT pLKO.1 2343 CDS 100% 2.640 1.848 N Tmcc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529852.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07509 pDONR223 100% 77.7% 80% None (many diffs) n/a
2 ccsbBroad304_07509 pLX_304 0% 77.7% 80% V5 (many diffs) n/a
Download CSV