Transcript: Mouse XM_006529912.3

PREDICTED: Mus musculus solute carrier family 35, member F5 (Slc35f5), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc35f5 (74150)
Length:
2683
CDS:
315..1751

Additional Resources:

NCBI RefSeq record:
XM_006529912.3
NBCI Gene record:
Slc35f5 (74150)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529912.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435364 CAGATGCTGAAGGTTACTTTG pLKO_005 598 CDS 100% 10.800 15.120 N SLC35F5 n/a
2 TRCN0000069042 GCAGTACAACAAGCCATTCTT pLKO.1 461 CDS 100% 5.625 3.938 N Slc35f5 n/a
3 TRCN0000326250 GCAGTACAACAAGCCATTCTT pLKO_005 461 CDS 100% 5.625 3.938 N Slc35f5 n/a
4 TRCN0000069038 CCACCTAAGTAAGATGACATT pLKO.1 2063 3UTR 100% 4.950 3.465 N Slc35f5 n/a
5 TRCN0000326248 CCACCTAAGTAAGATGACATT pLKO_005 2063 3UTR 100% 4.950 3.465 N Slc35f5 n/a
6 TRCN0000069041 GCTGAGTTCTTTACCTCCATT pLKO.1 221 5UTR 100% 4.950 3.465 N Slc35f5 n/a
7 TRCN0000326249 GCTGAGTTCTTTACCTCCATT pLKO_005 221 5UTR 100% 4.950 3.465 N Slc35f5 n/a
8 TRCN0000069040 GCACAAACATTGGGACCGAAA pLKO.1 715 CDS 100% 4.050 2.835 N Slc35f5 n/a
9 TRCN0000043865 GCACACTTGCACTAAGCCTTA pLKO.1 1459 CDS 100% 4.050 2.835 N SLC35F5 n/a
10 TRCN0000069039 CCACTGTGAAAGACCAAGAAT pLKO.1 838 CDS 100% 5.625 3.375 N Slc35f5 n/a
11 TRCN0000326307 CCACTGTGAAAGACCAAGAAT pLKO_005 838 CDS 100% 5.625 3.375 N Slc35f5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529912.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09022 pDONR223 100% 81.1% 87.2% None (many diffs) n/a
2 ccsbBroad304_09022 pLX_304 0% 81.1% 87.2% V5 (many diffs) n/a
3 TRCN0000470941 TAGCAGGATTGGTCCTCGGCACAA pLX_317 28.3% 81.1% 87.2% V5 (many diffs) n/a
Download CSV