Transcript: Mouse XM_006529952.3

PREDICTED: Mus musculus armadillo repeat containing 9 (Armc9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Armc9 (78795)
Length:
5493
CDS:
153..2633

Additional Resources:

NCBI RefSeq record:
XM_006529952.3
NBCI Gene record:
Armc9 (78795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529952.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201441 CCACGCTATAAACCTTGCTAA pLKO.1 4005 3UTR 100% 4.950 6.930 N Armc9 n/a
2 TRCN0000202440 GTGCTAGGAGACCATCTCATT pLKO.1 2148 CDS 100% 4.950 6.930 N Armc9 n/a
3 TRCN0000172914 GCTGAAATGATCCGCCAGATA pLKO.1 1824 CDS 100% 4.950 3.465 N ARMC9 n/a
4 TRCN0000192827 GAATTAAAGCTGAAGCTGGAA pLKO.1 675 CDS 100% 2.640 1.848 N Armc9 n/a
5 TRCN0000201478 CCTGGATTATGAGAAGCTGAA pLKO.1 1100 CDS 100% 4.050 2.430 N Armc9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529952.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12683 pDONR223 100% 54.6% 57.6% None (many diffs) n/a
2 ccsbBroad304_12683 pLX_304 0% 54.6% 57.6% V5 (many diffs) n/a
3 TRCN0000467154 ATCAGTGCCACCCTGGCCTAATTG pLX_317 23.5% 54.6% 57.6% V5 (many diffs) n/a
Download CSV