Transcript: Mouse XM_006530128.2

PREDICTED: Mus musculus intraflagellar transport 81 (Ift81), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ift81 (12589)
Length:
2932
CDS:
131..1984

Additional Resources:

NCBI RefSeq record:
XM_006530128.2
NBCI Gene record:
Ift81 (12589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250460 CGCATCTGCGTAACGTGATTT pLKO_005 2140 3UTR 100% 13.200 18.480 N Ift81 n/a
2 TRCN0000250459 TTCAAGCGATACGTCAGTAAA pLKO_005 1319 CDS 100% 13.200 18.480 N Ift81 n/a
3 TRCN0000191366 CGAACTTGAGACTAAAGTCAA pLKO.1 1060 CDS 100% 4.950 6.930 N Ift81 n/a
4 TRCN0000217456 GCCGTAGCTGTTGATCTTAAA pLKO.1 2617 3UTR 100% 13.200 9.240 N Ift81 n/a
5 TRCN0000250463 GGCAACAGGCATCCATCATTT pLKO_005 1164 CDS 100% 13.200 9.240 N Ift81 n/a
6 TRCN0000250462 TGGCTTCTTCAGCGGAGTAAT pLKO_005 440 CDS 100% 13.200 9.240 N Ift81 n/a
7 TRCN0000192134 GCACAACAGAAACAGGAACAA pLKO.1 797 CDS 100% 4.950 3.465 N Ift81 n/a
8 TRCN0000250461 TTTGGGACCAATGCAACTATT pLKO_005 214 CDS 100% 13.200 7.920 N Ift81 n/a
9 TRCN0000191754 GAATGTTGAATCTTCTTGGTA pLKO.1 321 CDS 100% 3.000 1.800 N Ift81 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03054 pDONR223 100% 59.5% 58.7% None (many diffs) n/a
2 ccsbBroad304_03054 pLX_304 0% 59.5% 58.7% V5 (many diffs) n/a
3 TRCN0000480355 CTTCTCTTCATGCTTACGGGAGCT pLX_317 29% 59.5% 58.7% V5 (many diffs) n/a
Download CSV