Transcript: Mouse XM_006530257.3

PREDICTED: Mus musculus coiled-coil domain containing 62 (Ccdc62), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc62 (208908)
Length:
2954
CDS:
72..2123

Additional Resources:

NCBI RefSeq record:
XM_006530257.3
NBCI Gene record:
Ccdc62 (208908)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252843 GAACCCTTCGGCGACCTTATA pLKO_005 203 CDS 100% 13.200 18.480 N Ccdc62 n/a
2 TRCN0000252840 TCAAAGCAAGATCGTACAAAT pLKO_005 960 CDS 100% 13.200 18.480 N Ccdc62 n/a
3 TRCN0000252839 GTCTACATGATGAGCTAATTT pLKO_005 889 CDS 100% 15.000 12.000 N Ccdc62 n/a
4 TRCN0000252841 TACCCATCAGCTGCGAGAATC pLKO_005 2038 CDS 100% 0.000 0.000 N Ccdc62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530257.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14311 pDONR223 100% 70.4% 11.4% None (many diffs) n/a
2 ccsbBroad304_14311 pLX_304 0% 70.4% 11.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479282 CGCTGTCTGTTCGAGCATTCCTTT pLX_317 20.1% 70.4% 11.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV