Transcript: Mouse XM_006530401.3

PREDICTED: Mus musculus family with sequence similarity 222, member A (Fam222a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam222a (433940)
Length:
3122
CDS:
647..2008

Additional Resources:

NCBI RefSeq record:
XM_006530401.3
NBCI Gene record:
Fam222a (433940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200159 CCAACCTACCCTCTATCCATA pLKO.1 1224 CDS 100% 4.950 3.465 N Fam222a n/a
2 TRCN0000182257 GACCAGCAAGAGTGTGTGTAA pLKO.1 1822 CDS 100% 4.950 3.465 N Fam222a n/a
3 TRCN0000198426 GCATTTACAAAGCTCTGAGAA pLKO.1 2994 3UTR 100% 4.950 3.465 N Fam222a n/a
4 TRCN0000181237 CAAAGAACAGATGCTGGGTAA pLKO.1 1912 CDS 100% 4.050 2.835 N Fam222a n/a
5 TRCN0000200238 CCCTGCATCAAAGAACAGATG pLKO.1 1904 CDS 100% 4.050 2.835 N Fam222a n/a
6 TRCN0000216884 GAGTATCTCATCAACGACATC pLKO.1 1877 CDS 100% 4.050 2.835 N Fam222a n/a
7 TRCN0000182865 CCTACCCTCTATCCATAGCAT pLKO.1 1228 CDS 100% 3.000 2.100 N Fam222a n/a
8 TRCN0000200215 CTTGGAACAGTGTTCTGGTGA pLKO.1 1692 CDS 100% 2.640 1.848 N Fam222a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09239 pDONR223 100% 85.1% 90.9% None (many diffs) n/a
2 ccsbBroad304_09239 pLX_304 0% 85.1% 90.9% V5 (many diffs) n/a
3 TRCN0000477989 AACAGTACCCACGGACTGATAAAA pLX_317 27.3% 85.1% 90.9% V5 (many diffs) n/a
Download CSV