Transcript: Mouse XM_006530404.1

PREDICTED: Mus musculus ring finger protein 10 (Rnf10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rnf10 (50849)
Length:
2440
CDS:
159..2225

Additional Resources:

NCBI RefSeq record:
XM_006530404.1
NBCI Gene record:
Rnf10 (50849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041128 CCCTAAGAAGATCAACCTGAA pLKO.1 209 CDS 100% 4.050 3.240 N Rnf10 n/a
2 TRCN0000288381 CCCTAAGAAGATCAACCTGAA pLKO_005 209 CDS 100% 4.050 3.240 N Rnf10 n/a
3 TRCN0000295642 TCCATCGGGTTTCCTCTCTGT pLKO_005 2247 3UTR 100% 2.640 2.112 N Rnf10 n/a
4 TRCN0000295647 ATGCATCCTGCACTATCTTTC pLKO_005 548 CDS 100% 10.800 7.560 N Rnf10 n/a
5 TRCN0000041129 CCCAAATCCAAGTGGGTGAAT pLKO.1 729 CDS 100% 4.950 3.465 N Rnf10 n/a
6 TRCN0000041132 GTGGTAGAGATTGCTGGGTAT pLKO.1 1422 CDS 100% 4.050 2.835 N Rnf10 n/a
7 TRCN0000041130 CCTGTTTCATTGAGGCTGCTA pLKO.1 901 CDS 100% 2.640 1.848 N Rnf10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07510 pDONR223 100% 76.8% 78.3% None (many diffs) n/a
2 ccsbBroad304_07510 pLX_304 0% 76.8% 78.3% V5 (many diffs) n/a
3 TRCN0000467243 AGGGGGGAGTATGCTCTATGCATA pLX_317 14.2% 76.8% 78.3% V5 (many diffs) n/a
Download CSV