Transcript: Mouse XM_006530454.3

PREDICTED: Mus musculus ankyrin repeat domain 13a (Ankrd13a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ankrd13a (68420)
Length:
3473
CDS:
307..2076

Additional Resources:

NCBI RefSeq record:
XM_006530454.3
NBCI Gene record:
Ankrd13a (68420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178073 GAACACTTCGATCTTTCCCAA pLKO.1 904 CDS 100% 2.640 3.696 N Ankrd13a n/a
2 TRCN0000297223 GAACACTTCGATCTTTCCCAA pLKO_005 904 CDS 100% 2.640 3.696 N Ankrd13a n/a
3 TRCN0000182611 GCTACACCAAAGGCAGCTAAT pLKO.1 2769 3UTR 100% 10.800 8.640 N Ankrd13a n/a
4 TRCN0000279525 GCTACACCAAAGGCAGCTAAT pLKO_005 2769 3UTR 100% 10.800 8.640 N Ankrd13a n/a
5 TRCN0000279629 TAAACAACGTGAGCGTGATAA pLKO_005 1118 CDS 100% 13.200 9.240 N Ankrd13a n/a
6 TRCN0000297225 CACGGATCACATTCGGAAATG pLKO_005 1571 CDS 100% 10.800 7.560 N Ankrd13a n/a
7 TRCN0000200277 CCAACGATGTCTGTCGCATAT pLKO.1 731 CDS 100% 10.800 7.560 N Ankrd13a n/a
8 TRCN0000198233 GCTGTCTCTCACTGAGAAATA pLKO.1 2055 CDS 100% 13.200 7.920 N Ankrd13a n/a
9 TRCN0000297224 GCTGTCTCTCACTGAGAAATA pLKO_005 2055 CDS 100% 13.200 7.920 N Ankrd13a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12919 pDONR223 100% 37.9% 39.2% None (many diffs) n/a
2 ccsbBroad304_12919 pLX_304 0% 37.9% 39.2% V5 (many diffs) n/a
3 TRCN0000468810 TCGCTGGAGGCTTTATGGGGCCGT pLX_317 50.8% 37.9% 39.2% V5 (many diffs) n/a
Download CSV