Transcript: Mouse XM_006530512.2

PREDICTED: Mus musculus ring finger protein 34 (Rnf34), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rnf34 (80751)
Length:
1811
CDS:
182..1093

Additional Resources:

NCBI RefSeq record:
XM_006530512.2
NBCI Gene record:
Rnf34 (80751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233440 ACTCGATTAGCCATGTATATT pLKO_005 1487 3UTR 100% 15.000 21.000 N Rnf34 n/a
2 TRCN0000037289 CCCTCAGTTGATGCGACTAAA pLKO.1 298 CDS 100% 13.200 18.480 N Rnf34 n/a
3 TRCN0000233438 CCCTCAGTTGATGCGACTAAA pLKO_005 298 CDS 100% 13.200 18.480 N Rnf34 n/a
4 TRCN0000037290 GCACAGGTACAAAGTGAAATA pLKO.1 590 CDS 100% 13.200 9.240 N Rnf34 n/a
5 TRCN0000233439 GGCACAGGTACAAAGTGAAAT pLKO_005 589 CDS 100% 13.200 9.240 N Rnf34 n/a
6 TRCN0000037291 CGGCTGTACAAAGAGAATGAA pLKO.1 866 CDS 100% 5.625 3.938 N Rnf34 n/a
7 TRCN0000037292 CCGCAGATGTTCTACTTGTCA pLKO.1 250 CDS 100% 3.000 2.100 N Rnf34 n/a
8 TRCN0000037293 TGGACTCAAGTAGCCTGAATT pLKO.1 438 CDS 100% 0.000 0.000 N Rnf34 n/a
9 TRCN0000129405 GATGATGACGACGACGATGAT pLKO.1 629 CDS 100% 4.950 2.475 Y C1orf174 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04187 pDONR223 100% 68.5% 70.7% None (many diffs) n/a
2 ccsbBroad304_04187 pLX_304 0% 68.5% 70.7% V5 (many diffs) n/a
3 TRCN0000481577 ATTTTATTCAAGTGATTGCGGGAT pLX_317 48.8% 68.5% 70.7% V5 (many diffs) n/a
Download CSV