Transcript: Mouse XM_006530577.3

PREDICTED: Mus musculus nuclear receptor subfamily 3, group C, member 2 (Nr3c2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nr3c2 (110784)
Length:
4534
CDS:
112..3054

Additional Resources:

NCBI RefSeq record:
XM_006530577.3
NBCI Gene record:
Nr3c2 (110784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026037 CGGCAAATCTTAACAATTCAA pLKO.1 1010 CDS 100% 5.625 7.875 N Nr3c2 n/a
2 TRCN0000025968 GCTCTACTTTACGAAGTGTTT pLKO.1 1868 CDS 100% 4.950 6.930 N Nr3c2 n/a
3 TRCN0000026051 CCAAGGTACTTCCAGGATTTA pLKO.1 2450 CDS 100% 13.200 9.240 N Nr3c2 n/a
4 TRCN0000025970 CCTTTCCCTAAGACAGAGGAA pLKO.1 1228 CDS 100% 2.640 1.848 N Nr3c2 n/a
5 TRCN0000026025 CCATGGGTTTATACATGGATT pLKO.1 422 CDS 100% 0.495 0.347 N Nr3c2 n/a
6 TRCN0000336629 TACCCTTGGTTTGCACATAAA pLKO_005 3444 3UTR 100% 0.000 0.000 N NR3C2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487851 GTAACGAGTTACCTGGTTAACTCC pLX_317 9.8% 86.4% 90.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV