Transcript: Mouse XM_006530634.3

PREDICTED: Mus musculus cadherin 8 (Cdh8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdh8 (12564)
Length:
6687
CDS:
606..2849

Additional Resources:

NCBI RefSeq record:
XM_006530634.3
NBCI Gene record:
Cdh8 (12564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530634.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094385 GCTGGCACAATCTTTCAAATA pLKO.1 918 CDS 100% 13.200 10.560 N Cdh8 n/a
2 TRCN0000094388 GCATCCGAATATGAGGCATTT pLKO.1 2094 CDS 100% 10.800 8.640 N Cdh8 n/a
3 TRCN0000094387 CGTAAGGATATTAAACCAGAT pLKO.1 2694 CDS 100% 4.050 3.240 N Cdh8 n/a
4 TRCN0000054226 CGCCAGAAGCAAGAAGTCTAT pLKO.1 2301 CDS 100% 4.950 3.465 N CDH8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530634.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05974 pDONR223 100% 83.5% 84.6% None (many diffs) n/a
2 ccsbBroad304_05974 pLX_304 0% 83.5% 84.6% V5 (many diffs) n/a
3 TRCN0000479005 CGACCGTGTACTGCATGTCGAGAT pLX_317 17.4% 83.5% 84.6% V5 (many diffs) n/a
Download CSV