Transcript: Mouse XM_006530667.3

PREDICTED: Mus musculus zinc finger, CCHC domain containing 14 (Zcchc14), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zcchc14 (142682)
Length:
7183
CDS:
405..3650

Additional Resources:

NCBI RefSeq record:
XM_006530667.3
NBCI Gene record:
Zcchc14 (142682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313590 CCTTCTAGGCTCACGTAATTC pLKO_005 3941 3UTR 100% 13.200 9.240 N Zcchc14 n/a
2 TRCN0000349899 GCTGCGCTTGCACAAGTATTA pLKO_005 1754 CDS 100% 13.200 9.240 N Zcchc14 n/a
3 TRCN0000313591 TGGTACACACACCCTACAATG pLKO_005 3382 CDS 100% 10.800 7.560 N Zcchc14 n/a
4 TRCN0000040731 CGACCACGTTAGGAAGTTCTT pLKO.1 1409 CDS 100% 4.950 3.465 N Zcchc14 n/a
5 TRCN0000317090 CGACCACGTTAGGAAGTTCTT pLKO_005 1409 CDS 100% 4.950 3.465 N Zcchc14 n/a
6 TRCN0000040728 GCACAAGTATTACCCTGTCTT pLKO.1 1763 CDS 100% 4.950 3.465 N Zcchc14 n/a
7 TRCN0000040730 GCAGACTTCTTGTCCCAACAA pLKO.1 2795 CDS 100% 4.950 3.465 N Zcchc14 n/a
8 TRCN0000040729 GCCTGGAGAATGCATTGCATA pLKO.1 1036 CDS 100% 4.950 3.465 N Zcchc14 n/a
9 TRCN0000317152 GCCTGGAGAATGCATTGCATA pLKO_005 1036 CDS 100% 4.950 3.465 N Zcchc14 n/a
10 TRCN0000040732 CTATGTCAGTACCCAGCAGTA pLKO.1 3338 CDS 100% 4.050 2.835 N Zcchc14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07847 pDONR223 100% 72% 73.2% None (many diffs) n/a
2 ccsbBroad304_07847 pLX_304 0% 72% 73.2% V5 (many diffs) n/a
3 TRCN0000480314 GACAGTCTCCGACTGGGCACGTGT pLX_317 13.5% 72% 73.2% V5 (many diffs) n/a
Download CSV