Transcript: Mouse XM_006530752.3

PREDICTED: Mus musculus metallothionein 1 (Mt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mt1 (17748)
Length:
760
CDS:
228..626

Additional Resources:

NCBI RefSeq record:
XM_006530752.3
NBCI Gene record:
Mt1 (17748)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219455 TCCCGTGGGCTGCTCCAAATG pLKO.1 551 CDS 100% 0.000 0.000 N Mt1 n/a
2 TRCN0000219451 CCTGCAAGAACTGCAAGTGCA pLKO.1 286 CDS 100% 2.640 1.848 N Mt1 n/a
3 TRCN0000219453 CAAATGTGCCCAGGGCTGTGT pLKO.1 566 CDS 100% 0.880 0.616 N Mt1 n/a
4 TRCN0000219452 AGTGCACCTCCTGCAAGAAGA pLKO.1 301 CDS 100% 4.950 2.970 N Mt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530752.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01040 pDONR223 100% 39.6% 39.3% None (many diffs) n/a
2 ccsbBroad304_01040 pLX_304 0% 39.6% 39.3% V5 (many diffs) n/a
3 TRCN0000465872 GTAGAGTCACTGCCTTGTCCTAGG pLX_317 100% 39.6% 39.3% V5 (many diffs) n/a
4 ccsbBroadEn_13207 pDONR223 100% 38.3% 37.1% None (many diffs) n/a
5 ccsbBroad304_13207 pLX_304 0% 38.3% 37.1% V5 (many diffs) n/a
6 TRCN0000467056 AGATTTTCATGCAACTTTTCTCGA pLX_317 100% 38.3% 37.1% V5 (many diffs) n/a
Download CSV