Transcript: Mouse XM_006530788.1

PREDICTED: Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 2 (St3gal2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
St3gal2 (20444)
Length:
3968
CDS:
1147..2199

Additional Resources:

NCBI RefSeq record:
XM_006530788.1
NBCI Gene record:
St3gal2 (20444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018839 CCGAACAACTCACCATTTCAT pLKO.1 1725 CDS 100% 5.625 7.875 N St3gal2 n/a
2 TRCN0000278763 CCGAACAACTCACCATTTCAT pLKO_005 1725 CDS 100% 5.625 7.875 N St3gal2 n/a
3 TRCN0000018840 CGTCTGGACCAGAGATAACAT pLKO.1 1431 CDS 100% 5.625 7.875 N St3gal2 n/a
4 TRCN0000278819 CGTCTGGACCAGAGATAACAT pLKO_005 1431 CDS 100% 5.625 7.875 N St3gal2 n/a
5 TRCN0000018838 GAATGGTTTGACAGCCACTTT pLKO.1 1393 CDS 100% 4.950 3.465 N St3gal2 n/a
6 TRCN0000018841 GTGCTCTTCTTTGCACTACAT pLKO.1 1993 CDS 100% 4.950 2.970 N St3gal2 n/a
7 TRCN0000278818 GTGCTCTTCTTTGCACTACAT pLKO_005 1993 CDS 100% 4.950 2.970 N St3gal2 n/a
8 TRCN0000018837 CCAGATTTACAACCCAGCCTT pLKO.1 1908 CDS 100% 2.640 1.584 N St3gal2 n/a
9 TRCN0000297210 CCAGATTTACAACCCAGCCTT pLKO_005 1908 CDS 100% 2.640 1.584 N St3gal2 n/a
10 TRCN0000035636 AGTCCTTCCTTCGAGTGGATA pLKO.1 1877 CDS 100% 4.950 3.465 N ST3GAL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01533 pDONR223 100% 89.2% 94.2% None (many diffs) n/a
2 ccsbBroad304_01533 pLX_304 0% 89.2% 94.2% V5 (many diffs) n/a
3 TRCN0000469874 TATTGCCTCCACTAGAGTTCACCA pLX_317 22.8% 89.2% 94.2% V5 (many diffs) n/a
Download CSV