Transcript: Mouse XM_006530795.4

PREDICTED: Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18 (Adamts18), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Adamts18 (208936)
Length:
6475
CDS:
868..4629

Additional Resources:

NCBI RefSeq record:
XM_006530795.4
NBCI Gene record:
Adamts18 (208936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031640 GCCCAAGATATGCAACGCTTT pLKO.1 3735 CDS 100% 4.050 5.670 N Adamts18 n/a
2 TRCN0000031639 GCCGACAGTATCTAAAGAAAT pLKO.1 2402 CDS 100% 13.200 10.560 N Adamts18 n/a
3 TRCN0000031643 CCACGTTTGAATACCAGCGTT pLKO.1 3419 CDS 100% 2.640 2.112 N Adamts18 n/a
4 TRCN0000031642 CCCAACAGTGTGCAGAGTATA pLKO.1 2924 CDS 100% 13.200 9.240 N Adamts18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09783 pDONR223 100% 83% 86.1% None (many diffs) n/a
2 ccsbBroad304_09783 pLX_304 0% 83% 86.1% V5 (many diffs) n/a
3 TRCN0000470889 TGCTCACCGTACAGGGACGCAGAC pLX_317 13.6% 83% 86.1% V5 (many diffs) n/a
Download CSV