Transcript: Mouse XM_006530876.3

PREDICTED: Mus musculus solute carrier family 38, member 7 (Slc38a7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc38a7 (234595)
Length:
3357
CDS:
317..1708

Additional Resources:

NCBI RefSeq record:
XM_006530876.3
NBCI Gene record:
Slc38a7 (234595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437293 GGTACGTCACCGCCATTATAA pLKO_005 954 CDS 100% 15.000 21.000 N Slc38a7 n/a
2 TRCN0000421620 GGTAGCCATTGCGGTCTATAC pLKO_005 712 CDS 100% 10.800 15.120 N Slc38a7 n/a
3 TRCN0000430311 AGCTGCTGACATCATATAAAT pLKO_005 2181 3UTR 100% 15.000 10.500 N Slc38a7 n/a
4 TRCN0000060156 GACCAGCAGGACAAGATTATA pLKO.1 770 CDS 100% 15.000 10.500 N SLC38A7 n/a
5 TRCN0000102214 GAGATTGGCTTCCAGAAATAT pLKO.1 905 CDS 100% 15.000 10.500 N Slc38a7 n/a
6 TRCN0000102210 CCCTTCCTGTTTCCATCTTTA pLKO.1 2633 3UTR 100% 13.200 9.240 N Slc38a7 n/a
7 TRCN0000102211 GCTCACCTCCTATCCAATCTT pLKO.1 1315 CDS 100% 5.625 3.938 N Slc38a7 n/a
8 TRCN0000102212 CAGTGTCATGTGAGTAGTGTA pLKO.1 1085 CDS 100% 4.950 3.465 N Slc38a7 n/a
9 TRCN0000060153 CTGTGCCTCATTCAAGCCAAA pLKO.1 1553 CDS 100% 4.050 2.835 N SLC38A7 n/a
10 TRCN0000102213 CCTCCTATCCAATCTTGCACT pLKO.1 1320 CDS 100% 2.640 1.848 N Slc38a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03558 pDONR223 100% 89.2% 94.8% None (many diffs) n/a
2 ccsbBroad304_03558 pLX_304 0% 89.2% 94.8% V5 (many diffs) n/a
3 TRCN0000468239 CTGATCCGCTGCAACAGCATCTCA pLX_317 34.9% 89.2% 94.8% V5 (many diffs) n/a
Download CSV