Transcript: Mouse XM_006530978.3

PREDICTED: Mus musculus differentially expressed in FDCP 8 (Def8), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Def8 (23854)
Length:
3160
CDS:
109..1455

Additional Resources:

NCBI RefSeq record:
XM_006530978.3
NBCI Gene record:
Def8 (23854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105902 CGTTAAACAGACCTGCGATAA pLKO.1 543 CDS 100% 10.800 15.120 N Def8 n/a
2 TRCN0000354203 CGTTAAACAGACCTGCGATAA pLKO_005 543 CDS 100% 10.800 15.120 N Def8 n/a
3 TRCN0000105904 AGCGTTAAACAGACCTGCGAT pLKO.1 541 CDS 100% 2.640 3.696 N Def8 n/a
4 TRCN0000105900 CGCTTCCTCTTTGGCGTTAAA pLKO.1 2984 3UTR 100% 13.200 9.240 N Def8 n/a
5 TRCN0000354131 CGCTTCCTCTTTGGCGTTAAA pLKO_005 2984 3UTR 100% 13.200 9.240 N Def8 n/a
6 TRCN0000105903 CGAAGAATGCAAACAGGTGAT pLKO.1 366 CDS 100% 4.050 2.835 N Def8 n/a
7 TRCN0000332181 CGAAGAATGCAAACAGGTGAT pLKO_005 366 CDS 100% 4.050 2.835 N Def8 n/a
8 TRCN0000105901 GCCATACTTCATCACCTGCAA pLKO.1 1050 CDS 100% 2.640 1.848 N Def8 n/a
9 TRCN0000332255 GCCATACTTCATCACCTGCAA pLKO_005 1050 CDS 100% 2.640 1.848 N Def8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03468 pDONR223 100% 37.3% 33.4% None (many diffs) n/a
2 ccsbBroad304_03468 pLX_304 0% 37.3% 33.4% V5 (many diffs) n/a
3 TRCN0000471991 CACGAACCGTACTAAAGGATGGAT pLX_317 59.7% 37.3% 33.4% V5 (many diffs) n/a
Download CSV