Transcript: Mouse XM_006531025.1

PREDICTED: Mus musculus signal-induced proliferation-associated 1 like 2 (Sipa1l2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sipa1l2 (244668)
Length:
6698
CDS:
508..5622

Additional Resources:

NCBI RefSeq record:
XM_006531025.1
NBCI Gene record:
Sipa1l2 (244668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253359 GTTGCTGTAGAGACGTATTTA pLKO_005 6162 3UTR 100% 15.000 12.000 N Sipa1l2 n/a
2 TRCN0000253358 CACTCCCTCTATACCACATAT pLKO_005 2509 CDS 100% 13.200 9.240 N Sipa1l2 n/a
3 TRCN0000253356 AGGTCAAACGCTACATCATAG pLKO_005 1922 CDS 100% 10.800 7.560 N Sipa1l2 n/a
4 TRCN0000253355 ATAGAGAGTTATGACCCTAAA pLKO_005 1159 CDS 100% 10.800 7.560 N Sipa1l2 n/a
5 TRCN0000253357 TACCCGAACAAGGCAAGAATA pLKO_005 2913 CDS 100% 0.000 0.000 N Sipa1l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531025.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12366 pDONR223 100% 26.3% 27.9% None (many diffs) n/a
2 ccsbBroad304_12366 pLX_304 0% 26.3% 27.9% V5 (many diffs) n/a
3 TRCN0000466707 CGTGTCACTGTCCATGGGCTACTC pLX_317 26.2% 26.3% 27.9% V5 (many diffs) n/a
Download CSV