Transcript: Mouse XM_006531127.2

PREDICTED: Mus musculus adhesion G protein-coupled receptor L1 (Adgrl1), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrl1 (330814)
Length:
6960
CDS:
210..4097

Additional Resources:

NCBI RefSeq record:
XM_006531127.2
NBCI Gene record:
Adgrl1 (330814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242211 CCCACTGGAGTGACCATATTT pLKO_005 4808 3UTR 100% 15.000 21.000 N Adgrl1 n/a
2 TRCN0000242207 GATCTACCAAGGCCGTATTAA pLKO_005 2225 CDS 100% 15.000 21.000 N Adgrl1 n/a
3 TRCN0000242210 CATCGCAGCATCTATCAATAA pLKO_005 1979 CDS 100% 13.200 10.560 N Adgrl1 n/a
4 TRCN0000242209 ATTCACGCACCAAGTACTATT pLKO_005 2557 CDS 100% 13.200 9.240 N Adgrl1 n/a
5 TRCN0000215672 GATGGAACAACTGCTAGATAT pLKO.1 1409 CDS 100% 13.200 9.240 N Adgrl1 n/a
6 TRCN0000175745 GCTTGAGTCATGGAAAGACAT pLKO.1 1577 CDS 100% 4.950 3.465 N Adgrl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488106 TCCCCTTGACCAGATCTTTGAGAA pLX_317 5.1% 79% 86.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV