Transcript: Mouse XM_006531146.3

PREDICTED: Mus musculus genetic suppressor element 1, coiled-coil protein (Gse1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gse1 (382034)
Length:
7680
CDS:
976..5607

Additional Resources:

NCBI RefSeq record:
XM_006531146.3
NBCI Gene record:
Gse1 (382034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531146.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250260 CGGCAATCCACTACAACATTC pLKO_005 5135 CDS 100% 10.800 15.120 N Gse1 n/a
2 TRCN0000201437 CAAGGGATTGAGGCAATCTTT pLKO.1 5323 CDS 100% 5.625 7.875 N Gse1 n/a
3 TRCN0000258022 GGTGAAGGTGGAGCGAGTTTA pLKO_005 3936 CDS 100% 13.200 10.560 N Gse1 n/a
4 TRCN0000201072 CGAAGAGTTTGCACATCAATT pLKO.1 5019 CDS 100% 13.200 9.240 N Gse1 n/a
5 TRCN0000250259 CGAAGAGTTTGCACATCAATT pLKO_005 5019 CDS 100% 13.200 9.240 N Gse1 n/a
6 TRCN0000217001 CTAGGCTGAACCTATAGTATA pLKO.1 5622 3UTR 100% 13.200 9.240 N Gse1 n/a
7 TRCN0000250261 CTAGGCTGAACCTATAGTATA pLKO_005 5622 3UTR 100% 13.200 9.240 N Gse1 n/a
8 TRCN0000250258 CAGGATGGATGACTCCTATTG pLKO_005 2868 CDS 100% 10.800 7.560 N Gse1 n/a
9 TRCN0000202457 GCAAGGGATTGAGGCAATCTT pLKO.1 5322 CDS 100% 5.625 3.938 N Gse1 n/a
10 TRCN0000130850 GAAGCTTACCAGGAACACATA pLKO.1 5344 CDS 100% 4.950 3.465 N GSE1 n/a
11 TRCN0000149840 CAGGAACACATAGAAGAGCAA pLKO.1 5353 CDS 100% 2.640 1.848 N GSE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531146.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07852 pDONR223 100% 57.4% 60.8% None (many diffs) n/a
2 ccsbBroad304_07852 pLX_304 0% 57.4% 60.8% V5 (many diffs) n/a
3 TRCN0000479184 CGAGTCAGGCCAAGCGTAAAACTA pLX_317 11.6% 57.4% 60.8% V5 (many diffs) n/a
Download CSV