Transcript: Mouse XM_006531216.3

PREDICTED: Mus musculus microtubule associated serine/threonine kinase 1 (Mast1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mast1 (56527)
Length:
4853
CDS:
87..4787

Additional Resources:

NCBI RefSeq record:
XM_006531216.3
NBCI Gene record:
Mast1 (56527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430076 TCCTCCTACGACAACGAAATT pLKO_005 579 CDS 100% 13.200 18.480 N Mast1 n/a
2 TRCN0000027976 GCAAAGTTATCAAGTCGGCTT pLKO.1 2800 CDS 100% 2.160 3.024 N Mast1 n/a
3 TRCN0000027967 CCACTTAGGTAGCAGTCCTTT pLKO.1 239 CDS 100% 4.950 3.465 N Mast1 n/a
4 TRCN0000028014 CGCAGCAGTTACAAAGCCAAA pLKO.1 3276 CDS 100% 4.050 2.835 N Mast1 n/a
5 TRCN0000027948 GCTTCTAATATCTAGCCTCTT pLKO.1 1934 CDS 100% 4.050 2.835 N Mast1 n/a
6 TRCN0000028032 CCAGAAGAGTTCTACCACCTT pLKO.1 960 CDS 100% 2.640 1.848 N Mast1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11656 pDONR223 100% 57.5% 62.4% None (many diffs) n/a
2 ccsbBroad304_11656 pLX_304 0% 57.5% 62.4% V5 (many diffs) n/a
3 TRCN0000466906 AACAGACCGCCGCTGATACATACG pLX_317 11.4% 57.5% 62.4% V5 (many diffs) n/a
4 ccsbBroadEn_15002 pDONR223 0% 57.5% 62.4% None (many diffs) n/a
5 ccsbBroad304_15002 pLX_304 0% 57.5% 62.4% V5 (many diffs) n/a
6 TRCN0000466163 TCCGGCTGGTTATAACCAGTAAGC pLX_317 9.9% 57.5% 62.4% V5 (many diffs) n/a
Download CSV