Transcript: Mouse XM_006531276.3

PREDICTED: Mus musculus transmembrane protein 208 (Tmem208), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem208 (66320)
Length:
518
CDS:
102..404

Additional Resources:

NCBI RefSeq record:
XM_006531276.3
NBCI Gene record:
Tmem208 (66320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193364 CAGAGGGAAGAAACAGATATT pLKO.1 128 CDS 100% 13.200 9.240 N Tmem208 n/a
2 TRCN0000292600 CAGAGGGAAGAAACAGATATT pLKO_005 128 CDS 100% 13.200 9.240 N Tmem208 n/a
3 TRCN0000173239 CCTACTGACAGCCATTGTTCA pLKO.1 463 3UTR 100% 4.950 3.465 N Tmem208 n/a
4 TRCN0000129222 CCTTAAGGATGTGATCCTACT pLKO.1 448 3UTR 100% 4.050 2.835 N TMEM208 n/a
5 TRCN0000280869 CCTTAAGGATGTGATCCTACT pLKO_005 448 3UTR 100% 4.050 2.835 N TMEM208 n/a
6 TRCN0000193808 CCTTGGTCTTCTTCTATTCCT pLKO.1 223 CDS 100% 3.000 2.100 N Tmem208 n/a
7 TRCN0000292599 CCTTGGTCTTCTTCTATTCCT pLKO_005 223 CDS 100% 3.000 2.100 N Tmem208 n/a
8 TRCN0000174887 GAACAAAGAAACTCTCAAGTT pLKO.1 155 CDS 100% 4.950 2.970 N Tmem208 n/a
9 TRCN0000292643 GAACAAAGAAACTCTCAAGTT pLKO_005 155 CDS 100% 4.950 2.970 N Tmem208 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11898 pDONR223 100% 90% 96% None (many diffs) n/a
2 ccsbBroad304_11898 pLX_304 0% 90% 96% V5 (many diffs) n/a
3 TRCN0000475070 TAAATAGTGGTCGTTCTTAACGTT pLX_317 95.6% 90% 96% V5 (many diffs) n/a
4 ccsbBroadEn_03079 pDONR223 100% 52% 55.4% None (many diffs) n/a
5 ccsbBroad304_03079 pLX_304 0% 52% 55.4% V5 (many diffs) n/a
6 TRCN0000469023 ACAACACGCAATGAAGCTTCATCG pLX_317 73.2% 52% 55.4% V5 (many diffs) n/a
7 ccsbBroadEn_08112 pDONR223 100% 51.8% 54.9% None (many diffs) n/a
8 ccsbBroad304_08112 pLX_304 0% 51.8% 54.9% V5 (many diffs) n/a
9 TRCN0000475367 AGGGCCACCATGGAACCACCTTTA pLX_317 30.4% 51.8% 54.9% V5 (many diffs) n/a
Download CSV