Transcript: Mouse XM_006531278.3

PREDICTED: Mus musculus dihydrouridine synthase 2 (Dus2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dus2 (66369)
Length:
1884
CDS:
106..1587

Additional Resources:

NCBI RefSeq record:
XM_006531278.3
NBCI Gene record:
Dus2 (66369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252095 GATACTTCTGGCATCATTAAA pLKO_005 1147 CDS 100% 15.000 21.000 N Dus2 n/a
2 TRCN0000252094 CCGGTCAGCTGTGAAGTTATA pLKO_005 685 CDS 100% 13.200 9.240 N Dus2 n/a
3 TRCN0000252093 GAAACAGTTCAGCGAACTATA pLKO_005 1270 CDS 100% 13.200 9.240 N Dus2 n/a
4 TRCN0000294011 GATCCTCAGCACTCTTGTTAA pLKO_005 522 CDS 100% 13.200 9.240 N DUS2 n/a
5 TRCN0000258170 TGATGGGTGCCAGGACCTAAA pLKO_005 1630 3UTR 100% 10.800 7.560 N Dus2 n/a
6 TRCN0000252092 TGGATTATGGAGCGGACATTG pLKO_005 200 CDS 100% 10.800 7.560 N Dus2 n/a
7 TRCN0000064792 CCACTACACCAACACCAAGTA pLKO.1 933 CDS 100% 4.950 3.465 N DUS2 n/a
8 TRCN0000286590 CCACTACACCAACACCAAGTA pLKO_005 933 CDS 100% 4.950 3.465 N DUS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531278.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03481 pDONR223 100% 88.2% 90.2% None (many diffs) n/a
2 ccsbBroad304_03481 pLX_304 0% 88.2% 90.2% V5 (many diffs) n/a
3 TRCN0000471503 TTTCTGAACCGCCCTTAATAACAA pLX_317 35.7% 88.2% 90.2% V5 (many diffs) n/a
Download CSV