Transcript: Mouse XM_006531798.1

PREDICTED: Mus musculus unc-93 homolog B1 (C. elegans) (Unc93b1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Unc93b1 (54445)
Length:
2099
CDS:
4..1701

Additional Resources:

NCBI RefSeq record:
XM_006531798.1
NBCI Gene record:
Unc93b1 (54445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175263 CTTCTTTATCTACAGTGGCTT pLKO.1 939 CDS 100% 2.640 2.112 N Unc93b1 n/a
2 TRCN0000175582 CAACTGATCCTGCACTATGAT pLKO.1 319 CDS 100% 5.625 3.938 N Unc93b1 n/a
3 TRCN0000175144 GATTTACTTCCTCAACAACTA pLKO.1 621 CDS 100% 4.950 3.465 N Unc93b1 n/a
4 TRCN0000173466 GCAGGACTTCATCTTCACCAT pLKO.1 1302 CDS 100% 2.640 1.848 N Unc93b1 n/a
5 TRCN0000194528 GCTGCCCATGATTTACTTCCT pLKO.1 612 CDS 100% 2.640 1.848 N Unc93b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04248 pDONR223 100% 74.1% 78.7% None (many diffs) n/a
2 ccsbBroad304_04248 pLX_304 0% 74.1% 78.7% V5 (many diffs) n/a
3 TRCN0000477552 CAAGAGCGCCTAAAGGCCGCTAAC pLX_317 17.1% 74.1% 78.7% V5 (many diffs) n/a
Download CSV