Transcript: Mouse XM_006531829.3

PREDICTED: Mus musculus FERM domain containing 8 (Frmd8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Frmd8 (67457)
Length:
2761
CDS:
184..1278

Additional Resources:

NCBI RefSeq record:
XM_006531829.3
NBCI Gene record:
Frmd8 (67457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531829.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012033 CCAGAGACATAGCTTAGCTTT pLKO.1 2300 3UTR 100% 4.950 3.960 N Frmd8 n/a
2 TRCN0000321108 CCAAGCACCAGCCCTATAAAC pLKO_005 452 CDS 100% 13.200 9.240 N Frmd8 n/a
3 TRCN0000012034 CCGTGGAGAATTTGTCCTCAA pLKO.1 317 CDS 100% 4.050 2.835 N Frmd8 n/a
4 TRCN0000350616 CCGTGGAGAATTTGTCCTCAA pLKO_005 317 CDS 100% 4.050 2.835 N Frmd8 n/a
5 TRCN0000012035 GCTGCTAAGGATCTACTCCAA pLKO.1 1233 CDS 100% 2.640 1.848 N Frmd8 n/a
6 TRCN0000350617 GCTGCTAAGGATCTACTCCAA pLKO_005 1233 CDS 100% 2.640 1.848 N Frmd8 n/a
7 TRCN0000012036 CCCACCGAAGTAGCGTCTCTT pLKO.1 233 CDS 100% 1.650 1.155 N Frmd8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531829.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14298 pDONR223 100% 66.5% 2.9% None (many diffs) n/a
2 ccsbBroad304_14298 pLX_304 0% 66.5% 2.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469037 GAATGTTTCTGAAAGGGAGACTTC pLX_317 30.3% 66.5% 2.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV