Transcript: Mouse XM_006531964.1

PREDICTED: Mus musculus glutamate receptor, metabotropic 6 (Grm6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grm6 (108072)
Length:
3105
CDS:
67..1560

Additional Resources:

NCBI RefSeq record:
XM_006531964.1
NBCI Gene record:
Grm6 (108072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437732 CACACAGCGTGATTGACTATG pLKO_005 1088 CDS 100% 10.800 15.120 N Grm6 n/a
2 TRCN0000440018 GGCATTCAAACCCGTGGTAAA pLKO_005 1853 3UTR 100% 10.800 15.120 N Grm6 n/a
3 TRCN0000026267 CCCAACAAGAAATCCAGGATT pLKO.1 1963 3UTR 100% 4.950 3.465 N Grm6 n/a
4 TRCN0000026269 CCACCACAACTATCATTGCTA pLKO.1 722 CDS 100% 3.000 2.100 N Grm6 n/a
5 TRCN0000026256 GCCCTTAGACTGGATATGGAA pLKO.1 412 CDS 100% 3.000 2.100 N Grm6 n/a
6 TRCN0000026247 GCTGAGAAGATCTACATCCAA pLKO.1 1354 CDS 100% 3.000 2.100 N Grm6 n/a
7 TRCN0000009032 AGCGTGATTGACTATGAGGAA pLKO.1 1093 CDS 100% 2.640 1.848 N GRM6 n/a
8 TRCN0000026290 CCAGTGATGTTCAATGAGAAT pLKO.1 295 CDS 100% 4.950 2.970 N Grm6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531964.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488833 CCCATTATCTCAGCGGCCTCCTCG pLX_317 10.1% 48.8% 53% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488042 CTCGTACGGCGAGAGTTATAGGCA pLX_317 8.6% 48.8% 52.9% V5 (many diffs) n/a
Download CSV