Transcript: Mouse XM_006531978.3

PREDICTED: Mus musculus solute carrier family 5 (sodium/glucose cotransporter), member 10 (Slc5a10), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc5a10 (109342)
Length:
2024
CDS:
29..1864

Additional Resources:

NCBI RefSeq record:
XM_006531978.3
NBCI Gene record:
Slc5a10 (109342)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006531978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252449 AGGGCTGATGATCGCAGTAAT pLKO_005 1171 CDS 100% 13.200 18.480 N Slc5a10 n/a
2 TRCN0000252450 AGCGCATCCGCACGTACTTAT pLKO_005 465 CDS 100% 13.200 9.240 N Slc5a10 n/a
3 TRCN0000258216 AGCTGAGTGTCACGGACATTA pLKO_005 177 CDS 100% 13.200 9.240 N Slc5a10 n/a
4 TRCN0000252451 TCCTCATGTGTGTCAACATTT pLKO_005 1821 CDS 100% 13.200 9.240 N Slc5a10 n/a
5 TRCN0000043642 CTGTCTGTCTTCACCAAGATA pLKO.1 503 CDS 100% 5.625 3.938 N SLC5A10 n/a
6 TRCN0000252448 GGAAGACAGGCGCTTCAAGTT pLKO_005 1884 3UTR 100% 4.950 3.465 N Slc5a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006531978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489178 AGCGATGGTCATCATCGAACCAGT pLX_317 20.8% 74.8% 78.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_13112 pDONR223 100% 61.1% 64.3% None (many diffs) n/a
3 ccsbBroad304_13112 pLX_304 0% 61.1% 64.3% V5 (many diffs) n/a
Download CSV